Powered by Trac 1.0.2
By Edgewall Software.
Power by Open Source Taskforce, NCHC, Taiwan
PRIMER_OPT_SIZE=20 PRIMER_MIN_SIZE=18 PRIMER_MAX_SIZE=27 PRIMER_OPT_TM=60.0 PRIMER_MIN_TM=57.0 PRIMER_MAX_TM=63.0 PRIMER_MAX_DIFF_TM=3.0 Avoid 3' instability and low-complexity regions.
The basic structure looks like this:
PRIMER_INTERNAL_OPT_SIZE=20 PRIMER_INTERNAL_MIN_SIZE=18 PRIMER_INTERNAL_MAX_SIZE=30 PRIMER_INTERNAL_OPT_TM=65.0 # Probe Tm should be 5-8°C higher than primers PRIMER_INTERNAL_MIN_TM=63.0 PRIMER_INTERNAL_MAX_TM=68.0 Here is a real-world input for amplifying a 200 bp region from a bacterial 16S rRNA gene: primer3 input -version 0.4.0-
For advanced use cases, pair Primer3 v0.4.0 with scripts (Perl, Python, or R) to parse output and iterate over multiple sequences. The input format described here remains compatible with later versions (v2.x, v3.x), making it a timeless skill for bioinformaticians. Use SEQUENCE for the template
PRIMER_SEQUENCE_ID=my_amplicon SEQUENCE=ATCGGCTAGCTAGCTCGATCGATCGATCGATGCGCTAGC PRIMER_TASK=pick_detection_primers = While many parameters are inherited from earlier versions, version 0.4.0 introduced refined control over mispriming libraries and output formatting. 1. Defining Your Sequence You must provide the target sequence. Use SEQUENCE for the template. For internal oligos (e.g., hybridization probes), use SEQUENCE_INTERNAL . pair Primer3 v0.4.0 with scripts (Perl
SEQUENCE=AGCTAGCTACGATCGATTCGATCGATCGATCGATCG Specify where primers can bind. Coordinates are 1-based.
PRIMER_PICK_LEFT_INPUT=1 # Start of left primer search region PRIMER_PICK_RIGHT_INPUT=500 # End of right primer search region To force primers to flank a specific SNP or target: